After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MUSK cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human MUSK Gene Plasmid Map
Human MUSK Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites

Muscle, skeletal receptor tyrosine-protein kinase, also known as Muscle-specific tyrosine-protein kinase receptor, Muscle-specific kinase receptor, and MUSK, is a single-pass type I membrane protein which belongs to the protein kinase superfamily and tyr protein kinase family. MUSK contains one FZ (frizzled) domain, three Ig-like C2-type (immunoglobulin-like) domains and one protein kinase domain. This protein is a muscle-specific tyrosine kinase receptor and it may play a role in clustering of the acetylcholine receptor in the postsynaptic neuromuscular junction. MUSK expression is increased in muscle cells stimulated with Wnt or at conditions when the Wnt signaling was activated. MUSK is a muscle-specific receptor tyrosine kinase that is activated by agrin. It has a critical role in neuromuscular synapse formation. MUSK is a receptor tyrosine kinase that is a key mediator of agrin's action and is involved in neuromuscular junction (NMJ) organization. Defects in MUSK encoding gene is a cause of autosomal recessive congenital myasthenic syndrome (CMS). Congenital myasthenic syndromes are inherited disorders of neuromuscular transmission that stem from mutations in presynaptic, synaptic, or postsynaptic proteins. MUSK mutations lead to decreased agrin-dependent AChR aggregation, a critical step in the formation of the neuromuscular junction. Mutations in this receptor encoding gene also have been associated with congenital myasthenic syndrome.

  • Glass D, et al. (1996) Agrin acts via a MuSK receptor complex. Cell. 85 (4): 513-23.
  • DeChiara T, et al. (1996) The receptor tyrosine kinase MuSK is required for neuromuscular junction formation in vivo. Cell. 85 (4): 501-12.
  • Hoch W, et al. (2001) Auto-antibodies to the receptor tyrosine kinase MuSK in patients with myasthenia gravis without acetylcholine receptor antibodies. Nat Med. 7 (3): 365-8.
  • Images
    • Human MUSK Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items