After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human XPNPEP2 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human XPNPEP2 Gene Plasmid Map
Human XPNPEP2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Aminopeptidase P (APP) is a hydrolase specific for N-terminal imido bonds, which are common to several collagen degradation products, neuropeptides, vasoactive peptides, and cytokines. A membrane-bound and soluble form of this enzyme (XPNPEP2) have been identified as products of two separate genes. XPNPEP2, the X-linked gene that encodes membranous aminopeptidase P (APP), has been reported to associate with APP activity. The membrane aminopeptidase P (XPNPEP2) is largely limited in distribution to endothelia and brush border epithelia. APP and XPNPEP2 contain homologous blocks of sequence common to members of the "pita bread-fold" protein family, of which Escherichia coli methionine aminopeptidase is the prototype. The C-2399A variant in XPNPEP2 is associated with reduced APP activity and a higher incidence of AE-ACEi. XPNPEP2 mRNA was detected in fibroblasts that carry the translocation, suggesting that this gene at least partially escapes X inactivation. XPNPEP2 is a candidate gene for premature ovarian failure (POF).

  • Sprinkle TJ, et al. (2000) Cloning, chromosomal sublocalization of the human soluble aminopeptidase P gene (XPNPEP1) to 10q25.3 and conservation of the putative proton shuttle and metal ligand binding sites with XPNPEP2. Arch Biochem Biophys. 378(1): 51-6.
  • Prueitt RL, et al. (2000) Physical mapping of nine Xq translocation breakpoints and identification of XPNPEP2 as a premature ovarian failure candidate gene. Cytogenet Cell Genet. 89(1-2): 44-50.
  • Duan QL, et al. (2005) A variant in XPNPEP2 is associated with angioedema induced by angiotensin I-converting enzyme inhibitors. Am J Hum Genet. 77(4): 617-26.
  • Woodard-Grice AV, et al. (2010) Sex-dependent and race-dependent association of XPNPEP2 C-2399A polymorphism with angiotensin-converting enzyme inhibitor-associated angioedema. Pharmacogenet Genomics. 20(9): 532-6.
  • Images
    • Human XPNPEP2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items