After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CLEC12A cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

CLEC12A is a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signaling, glycoprotein turnover, and roles in inflammation and immune response. CLEC12A is a negative regulator of granulocyte and monocyte function. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. C-type lectins are the most diverse and prevalent lectin family in immunity. Using a novel CLEC12A -specific monoclonal antibody, experiments had shown that human CLEC12A was expressed primarily on myeloid cells, including granulocytes, monocytes, macrophages, and dendritic cells. Although CLEC12A was highly N-glycosylated in primary cells, the level of glycosylation was found to vary between cell types. CLEC12A surface expression was down-regulated during inflammatory/activation conditions in vitro, as well as during an in vivo model of acute inflammation. This suggests that CLEC12A may be involved in the control of myeloid cell activation during inflammation.

References
  • Lahoud MH, et al. (2009) The C-type lectin Clec12A present on mouse and human dendritic cells can serve as a target for antigen delivery and enhancement of antibody responses. J Immunol. 182(12): 7587-94.
  • Pyz E, et al. (2008) Characterisation of murine MICL (CLEC12A) and evidence for an endogenous ligand. Eur J Immunol. 38(4): 1157-63.
  • Marshall AS, et al. (2006) Human MICL (CLEC12A) is differentially glycosylated and is down-regulated following cellular activation. Eur J Immunol. 36(8): 2159-69.
  • Images
    • Human CLEC12A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"