After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IFNL3 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
Human IFNL3 Gene Plasmid Map
Human IFNL3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Background

Interleukin-28B (IL-28B) also known as Interferon lambda-3 and IFN-lambda-3, belongs to the type III interferon family of cytokines and are highly similar to IL-29. IL-28B belongs to the newly described interferon lambda (IFNλ) family of cytokines. IL-28B is a cytokine with immunomodulatory activity. It functions in Up-regulating MHC class I antigen expression. IL-28B displays potent antiviral activity and antitumor activity. This cytokine serves as ligand for the heterodimeric class II cytokine receptor composed of IL10RB and IL28RA. The ligand/receptor complex seems to signal through the Jak-STAT pathway. IL-28B, like IL-12, is capable of robustly enhancing adaptive immunity. Moreover, we describe for the first time how IL-28B reduces regulatory T-cell populations during DNA vaccination, whereas IL-12 increases this cellular subset. We also show that IL-28B, unlike IL-12, is able to increase the percentage of splenic CD8+ T cells in vaccinated animals, and that these cells are more granular and have higher antigen-specific cytolytic degranulation compared with cells taken from animals that received IL-12 as an adjuvant.

References
  • Ge D, et al.. (2009) Genetic variation in IL28B predicts hepatitis C treatment-induced viral clearance. Nature. 461(7262): 399-401.
  • Morrow MP, et al.. (2009) Comparative ability of IL-12 and IL-28B to regulate Treg populations and enhance adaptive cellular immunity. Blood. 113(23): 5868-77.
  • Sheppard P, et al.. (2003) IL-28, IL-29 and their class II cytokine receptor IL-28R. Nat Immunol. 4(1): 63-8.
  • Images
    • Human IFNL3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"