After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PRSS3 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Trypsin-3, also known as Trypsin III, brain trypsinogen, Serine protease 3 and PRSS3, is a secreted protein which belongs to the peptidase S1 family. Trypsin-3 / PRSS3 is expressed is in pancreas and brain. It contains one peptidase S1 domain. Trypsin-3 / PRSS3 can degrade intrapancreatic trypsin inhibitors that protect against CP. Genetic variants that cause higher mesotrypsin activity might increase the risk for chronic pancreatitis (CP). A sustained imbalance of pancreatic proteases and their inhibitors seems to be important for the development of CP. The trypsin inhibitor-degrading activity qualified PRSS3 as a candidate for a novel CP susceptibility gene. Trypsin-3 / PRSS3 has been implicated as a putative tumor suppressor gene due to its loss of expression, which is correlated with promoter hypermethylation, in esophageal squamous cell carcinoma and gastric adenocarcinoma.

References
  • Venter JC. et al., 2001, Science 291:1304-51.
  • Marsit,CJ. et al., 2005, Mol Carcinog 44 (2):146-50.
  • Rowen, L. et al., 2005, Mol Biol Evol. 22 (8):1712-20.
  • Rosendahl, J. et al., 2010, Pancreatology. 10 (2-3):243-9
  • Images
    • Human PRSS3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"