After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human THBD cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Thrombomodulin, also known as THBD(CD141), is an integral membrane protein which reduces blood coagulation by converting thrombin to an anticoagulant enzyme from a procoagulant enzyme. Thrombomodulin is expressed on the surface of endothelial cells and serves as a cofactor for thrombin. It is also expressed on human mesothelial cell, monocyte and a dendritic cell subset. Thrombomodulin functions as a cofactor in the thrombin-induced activation of protein C in the anticoagulant pathway by forming a 1:1 stoichiometric complex with thrombin. Thrombomodulin also regulates C3b inactivation by factor I. Mutations in the thrombomodulin gene have also been reported to be associated with atypical hemolytic-uremic syndrome.

References
  • Dzionek A, et al. (2002) Plasmacytoid dendritic cells: from specific surface markers to specific cellular functions. Hum Immunol. 63(12):1133-48.
  • Dzionek A, et al. (2000) BDCA-2, BDCA-3, and BDCA-4: three markers for distinct subsets of dendritic cells in human peripheral blood. J Immunol. 165(11):6037-46.
  • Wen DZ, et al. (1987) Human thrombomodulin: complete cDNA sequence and chromosome localization of the gene. Biochemistry. 26(14):4350-7.
  • Images
    • Human THBD Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"