Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PON3cDNA Clone Product Information
Gene_bank_ref_id:
cDNA Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
References
  • Draganov DI, et al. (2000) Rabbit serum paraoxonase 3 (PON3) is a high density lipoprotein-associated lactonase and protects low density lipoprotein against oxidation. J Biol Chem. 275(43): 33435-42.
  • Shih DM, et al. (2007) Decreased obesity and atherosclerosis in human paraoxonase 3 transgenic mice. Circ Res. 100(8): 1200-7.
  • Rosenblat M, et al. (2003) Mouse macrophage paraoxonase 2 activity is increased whereas cellular paraoxonase 3 activity is decreased under oxidative stress. Arterioscler Thromb Vasc Biol. 23(3): 468-74.
  • Size / Price
    Images
    • Human PON3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"