After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ADAM17 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human ADAM17 Gene Plasmid Map
Human ADAM17 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

ADAM17 is a member of the ADAM protein family of disintegrins and metalloproteases. ADAM17 is ubiquitously expressed in the human colon, with increased activity in the colonic mucosa of patients with ulcerative colitis, a main form of inflammatory bowel disease. The expression of ADAM17 may be inhibited by ethanol. It is involved in the processing of tumor necrosis factor alpha (TNF-α) at the surface of the cell, and from within the intracellular membranes of the trans-Golgi network. ADAM17 also plays a role in the release of a diverse variety of membrane-anchored cytokines, cell adhesion molecules, receptors, ligands, and enzymes. ADAM17 may play a prominent role in the Notch signaling pathway, during the proteolytic release of the Notch intracellular domain (from the Notch1 receptor) that occurs following ligand binding.

  • Poghosyan. et al., 2002, J Biol Chem. 277 (7): 4999-5007.
  • Li Y. et al., 2006, Blood. 108 (7): 2275-9.
  • Peiretti. et al., 2003, J Cell Sci. 116 (10): 1949-57.
  • Images
    • Human ADAM17 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items