Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human NRXN3 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human NRXN3 Gene Plasmid Map
Human NRXN3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Neurexin-3-beta, also known as Neurexin III-beta and NRXN3, is a single-pass type I  membrane protein which belongs to the neurexin family. It contains one laminin G-like domain. It is a neuronal cell surface protein that may be involved in cell recognition and cell adhesion. Neurexins are a family of proteins that function in the vertebrate nervous system as cell adhesion molecules and receptors. They are encoded by several unlinked genes of which two, NRXN1 and NRXN3, are among the largest known human genes. Three of the genes ( NRXN1, NRXN2, NRXN3 ) utilize two alternate promoters and include numerous alternatively spliced exons to generate thousands of distinct mRNA transcripts and protein isoforms. The majority of transcripts are produced from the upstream promoter and encode alpha-neurexin isoforms; a much smaller number of transcripts are produced from the downstream promoter and encode beta-neurexin isoforms. The alpha-neurexins contain EGF-like sequences and laminin G domains, and have been shown to interact with neurexophilins. The beta-neurexins lack EGF-like sequences and contain fewer laminin G domains than alpha-neurexins. NRXN3 have been linked to genetic predisposition towards a number of conditions such as alcohol or drug addiction, or obesity.

  • Occhi G. et al., 2002, Biochem. Biophys. Res. Commun. 298:151-5.
  • Rowen L, et al., 2002, Genomics. 79 (4): 587-97.
  • Olsen J.V. et al., 2006, Cell 127:635-48.
  • Hishimoto A, et al., 2007, Human Molecular Genetics.16 (23): 2880-91.
  • Oppermann F.S. et al., 2009, Mol. Cell. Proteomics 8:1751-64. 
  • Images
    • Human NRXN3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items