Quick Order

Human CD1B natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CD1B cDNA Clone Product Information
Gene_bank_ref_id:BC069481
RefSeq ORF Size:1002bp
cDNA Description:Full length Clone DNA of Homo sapiens CD1b molecule.
Gene Synonym:R1, CD1, CD1A
Species:Human
Vector:pCMV/hygro
Plasmid:pCMV-CD1B
Restriction Site:KpnI + XbaI (5.5kb + 1kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Human CD1B natural ORF mammalian expression plasmid on other vectors
Product nameProduct name
Background

CD1B contains 1 Ig-like (immunoglobulin-like) domain and belongs to the CD1 family. CD1 family members are transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. During protein synthesis and maturation, they bind endogenous lipids that are replaced by lipid or glycolipid antigens when the proteins are internalized and pass through endosomes, before trafficking back to the cell surface. CD1B localizes to late endosomes and lysosomes via a tyrosine-based motif in the cytoplasmic tail, and requires vesicular acidification to bind lipid antigens.. It is expressed on cortical thymocytes, epidermal Langerhans cells, dendritic cells, on certain T-cell leukemias, and in various other tissues. CD1B is an antigen-presenting protein that binds self and non-self lipid and glycolipid antigens and presents them to T-cell receptors on natural killer T-cells.

References
  • Coventry B, et al. (2004) CD1a in human cancers: a new role for an old molecule. Trends Immunol. 25 (5):242-8.
  • Martin LH, et al. (1988) Structure and expression of the human thymocyte antigens CD1a, CD1b, and CD1c. Proc Natl Acad Sci. 84(24):9189-93.
  • Aruffo A, et al. (1989) Expression of cDNA clones encoding the thymocyte antigens CD1a, b, c demonstrates a hierarchy of exclusion in fibroblasts. J Immunol. 143(5):1723-30.
  • Longley J, et al. (1989) Molecular cloning of CD1a (T6), a human epidermal dendritic cell marker related to class I MHC molecules. J Invest Dermatol. 92(4):628-31.
  • Size / Price
    Catalog: HG11831-G-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"