Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human KLK4 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human KLK4 Gene Plasmid Map
Human KLK4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Kallikrein-4, also known as Enamel matrix serine proteinase 1, Kallikrein-like protein 1, KLK-L1, Serine protease 17, KLK4, PRSS17 and EMSP1, is a secreted protein which belongs to the peptidase S1 family and Kallikrein subfamily. Kallikrein-4 / KLK4 is a serine protease expressed during enamel maturation, and proteolytic processing of the enamel matrix by KLK4 is critical for proper enamel formation. Kallikrein-4 / KLK4 contains one peptidase S1 domain. Kallikrein-4 / KLK4 is secreted by transition- and maturation-stage ameloblasts. KLK4 aggressively degrades the retained organic matrix following the termination of enamel protein secretion. Two proteases are secreted into the enamel matrix of developing teeth. The early protease is enamelysin (MMP-20). The late protease is kallikrein 4 (KLK4). The principle functions of MMP-20 and KLK4 in dental enamel formation are to facilitate the orderly replacement of organic matrix with mineral, generating an enamel layer that is harder, less porous, and unstained by retained enamel proteins. Defects in Kallikrein-4 / KLK4 are the cause of amelogenesis imperfecta hypomaturation type 2A1 (AI2A1) which is an autosomal recessive defect of enamel formation. The disorder involves both primary and secondary dentitions.

  • Human KLK4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items