Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CASP14 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Caspase 14 is a member of the caspase family. Caspases are a kind of cysteine proteinase consisting of a prodomain plus large and small catalytic subunits, that play a central role in cell apoptosis. Caspase 14 possesses an unusually short prodomain and is highly expressed in embryonic tissues but absent from most of the adult tissues except for the skin, which suggests a role in ontogenesis and skin physiology. Unlike the other short prodomain caspases(caspase-3, caspase-6, and caspase-7), Caspase 14 was not processed by multiple death stimuli including activation of members of the tumor necrosis factor receptor family and expression of proapaptotic members of the bcl-2 family. Caspase 14 has been described to be processed and activated by anti-Fas agonist antibody or TNF-related apoptosis inducing ligand in vivo. The expression and processing of this caspase may take part in keratinocyte terminal differentiation, which is essential for the skin barrier.

  • Hu SM, et al. (1998) Caspase-14 is a novel developmentally regulated protease. The journal of biological chemistry. 273: 29648-53.
  • Marc Van De Craen, et al. (1998) Identification of a new caspase homologue: caspase-14. Cell death differ. 5(10): 838-46.
  • Images
    • Human CASP14 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items