Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human HIST1H3A cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
Human HIST1H3A Gene Plasmid Map
Human HIST1H3A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Histone H3.1, also known as HIST1H3A, HIST1H3B, HIST1H3C, HIST1H3D, HIST1H3E, HIST1H3F, HIST1H3G, HIST1H3H, HIST1H3I, HIST1H3J, is a member of the histone H3 family which is a core component of nucleosome. It is expressed during S phase, then expression strongly decreases as cell division slows down during the process of differentiation. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling. Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures.

References
  • Lachner M, et al., 2001, Nature 410 (6824): 116-20.
  • Koessler H, et al., 2003, DNA Cell Biol. 22 (4): 233-41.
  • Macdonald N. et al., 2005, Mol. Cell 20: 199-211.
  • Hyllus D. et al., 2007, Genes Dev. 21: 3369-3380.
  • Garcia BA. et al., 2007, J. Biol. Chem. 282:7641-7655.
  • Yu L.-R. et al., 2007, J. Proteome Res. 6: 4150-4162.
  • Images
    • Human HIST1H3A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"