Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
KIR2DL4cDNA Clone Product Information
Gene_bank_ref_id:
cDNA Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
Background

KIR2DL4, also known as CD158d, is a member of the killer cell Ig-like receptor (KIR) family. KIRs are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous. KIR2DL4 is expressed in all NK cells and some T cells. KIR2DL4 activates the cytotoxicity of NK cells, despite the presence of an immunoreceptor tyrosine-based inhibition motif (ITIM) in its cytoplasmic tail. The ITIM was not necessary for activation of lysis by KIR2DL4. The activation signal of KIR2DL4 was sensitive to inhibition by another ITIM-containing receptor. The activation-deficient mutant of KIR2DL4 inhibited the signal delivered by the activating receptor CD16.

References
  • Selvakumar A. et al., 1997, Tissue Antigens. 48 (4 Pt 1): 285-94.
  • Selvakumar A. et al., 1997, Immunol Rev. 155: 183-96.
  • Selvakumar A. et al., 1997, Tissue Antigens. 49 (6): 564-73.
  • Size / Price
    Images
    • Human KIR2DL4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"