After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IL9R cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
  • Demoulin JB. et al. (1998) Interleukin 9 and its receptor: an overview of structure and function. Int Rev Immunol. 16 (3-4): 345-64.
  • Sliva D. et al. (1999) Tip60 interacts with human interleukin-9 receptor alpha-chain. Biochem Biophys Res Commun. 263 (1): 149-55.
  • Renauld JC. et al. (1995) Interleukin-9 and its receptor: involvement in mast cell differentiation and T cell oncogenesis. J Leukoc Biol. 57 (3): 353-60.
  • Images
    • Human IL9R Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items