Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IL9R cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
  • Demoulin JB. et al. (1998) Interleukin 9 and its receptor: an overview of structure and function. Int Rev Immunol. 16 (3-4): 345-64.
  • Sliva D. et al. (1999) Tip60 interacts with human interleukin-9 receptor alpha-chain. Biochem Biophys Res Commun. 263 (1): 149-55.
  • Renauld JC. et al. (1995) Interleukin-9 and its receptor: involvement in mast cell differentiation and T cell oncogenesis. J Leukoc Biol. 57 (3): 353-60.
  • Images
    • Human IL9R Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items