Quick Order

Human TERF1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TERF1cDNA Clone Product Information
cDNA Size:1260
cDNA Description:ORF Clone of Homo sapiens telomeric repeat binding factor (NIMA-interacting) 1 DNA.
Gene Synonym:TRF, PIN2, TRF1, TRBF1, t-TRF1, hTRF1-AS
Restriction Site:HindIII + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human TERF1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Related Products
Product nameProduct name

Telomeric repeat binding factor 1 (TRF1), also known as TERF1, the shelterin complex, which modulates the telomere structures. TRF1 protein structure contains a C-terminal Myb motif, a dimerization domain near its N-terminus and an acidic N-terminus. Pin2/TRF1 was originally identified as a protein bound to telomeric DNA (TRF1) and as a protein involved in mitotic regulation (Pin2). Pin2/TRF1 negatively regulates telomere length and importantly, its function is tightly regulated during the cell cycle, acting as an important regulator of mitosis. TRF1 can be bound and modulated by two nucleolar GTP-binding proteins, nucleostemin (NS) and guanine nucleotide binding protein-like 3-like (GNL3L), which exhibit apparently opposite effects on the protein degradation of TRF1. TRF1/TERF1 may has association with cancer. TRF1 may play a significant role in cell differentiation in non-small cell lung cancer (NSCLC). The expression level of TRF1 protein is significantly reduced in kidney cancer and the level is negatively correlated with malignant degree of the cancer. TRF1 expression in malignant gliomas cells, may play a role in the malignant progression of astroglial brain tumors.

  • Tsai RY. (2009) Nucleolar modulation of TRF1: a dynamic way to regulate telomere and cell cycle by nucleostemin and GNL3L. Cell Cycle. 8(18):2912-6.
  • Chen YC, et al. (2009) Phosphorylation of telomeric repeat binding factor 1 (TRF1) by Akt causes telomere shortening. Cancer Invest. 27(1): 24-8.
  • Hu J, et al. (2006) Expression of telomeric repeat binding factor 1 in non-small cell lung cancer. J Surg Oncol. 93(1): 62-7.
  • La Torre D, et al. (2005) Expression of telomeric repeat binding factor-1 in astroglial brain tumors. Neurosurgery. 56(4): 802-10.
  • Shi JM, et al. (2004) Expression of telomere repeat binding factor 1 (TRF1) protein in kidney cancer. Zhejiang Da Xue Xue Bao Yi Xue Ban. 33(6): 496-9, 508.
  • Zhou XZ, et al. (2003) Role of Pin2/TRF1 in telomere maintenance and cell cycle control. J Cell Biochem. 89(1): 19-37.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human TERF1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged