Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CEACAM8cDNA Clone Product Information
Gene_bank_ref_id:
cDNA Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
Background

CEACAM8, also known as CD66b or NCA-95, is a single chain, GPI-anchored, highly glycosylated protein belonging to the carcinoembryonic antigen family. There are four members in this family: CD66a, CD66b, CD66c, and CD66d. Members of CEACAM family are widely expressed especially on human neutrophils, and, depending on the tissue, capable of regulating diverse functions including tumor promotion, tumor suppression, angiogenesis, and neutrophil activation. Abnormal overexpression and downregulation of some CEACAMs have been described in tumor cells. Monoclonal antibodies grouped in the CD66 cluster recognize CEACAM members. Ectopic CD66 expression is commonly detected in B-cell lineage acute lymphoblastic leukemia (ALL). CEACAM8(CD66b) is also an activation marker for human granulocytes. However, its biological functions are largely unknown in eosinophils. It has been reported that CD66b is highly expressed on the surface of human peripheral blood eosinophils isolated from healthy individuals. Engagement of CD66b by mAb or a natural ligand, galectin-3, activated a Src kinase family molecule, hemopoietic cell kinase (Hck), and induced cellular adhesion, superoxide production, and degranulation of eosinophils. CD66b molecules were localized in lipid rafts, and disruption of lipid rafts or removal of the GPI anchor inhibited the adhesion and activation of eosinophils. Importantly, CD66b was constitutively and physically associated with a beta2 integrin, CD11b, and cross-linking of CD66b induced a striking clustering of CD11b molecules. Thus, CD66b molecules are involved in regulating adhesion and activation of eosinophils, possibly through their localization in lipid rafts and interaction with other cell surface molecules, such as CD11b. Binding of exogenous or endogenous carbohydrate ligands(s) to CD66b may be important in the release of proinflammatory mediators by human eosinophils.

References
  • Yoon J, et al. (2007) CD66b regulates adhesion and activation of human eosinophils. J Immunol. 179 (12): 8454-62.
  • Skubitz KM, et al. (1996) CD6a, CD66b, CD66c, and CD66d each independently stimulate neutrophils. J Leukoc Biol. 60 (1): 106-17.
  • Skubitz KM, et al. (2008) Inte rdependency of CEACAM-1, -3, -6, and -8 induced human neutrophil adhesion to endothelial cells. J Transl Med. 6: 78.
  • Lasa A, et al. (2008) High expression of CEACAM6 and CEACAM8 mRNA in acute lymphoblastic leukemias. Ann Hematol. 87 (3): 205-11.
  • Size / Price
    Images
    • Human CEACAM8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"