Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CD300C cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD300 is a glycoprotein family of cell surface molecules that regulate a diverse array of cell processes via their triggering and inhibitory receptor functions. The CD300 family of myeloid immunoglobulin receptors includes activating(CD300b, CD300e) and inhibitory members(CD300a, CD300f), as well as CD300c and CD300d, whose function is uncertain.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Lankry D, et al. (2010) Expression and function of CD300 in NK cells.185(5): 2877-86.
  • Agueda MB, et al. (2010) CD300 heterocomplexes, a new and family-restricted mechanism for myeloid cell signaling regulation. Journal of biological chemistry. 285: 41781-94.
  • Clark GJ, et al. (2009) The CD300 molecules regulate monocyte and dendritic cell functions. 214 (9-10): 730-6.
  • Images
    • Human CD300C Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items