After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MAP4K2 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
Human MAP4K2 Gene Plasmid Map
Human MAP4K2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Mitogen-activated protein kinase kinase kinase kinase 2, also known as B lymphocyte serine/threonine-protein kinase, Germinal center kinase, MAPK/ERK kinase kinase kinase 2, MEK kinase kinase 2, Rab8-interacting protein and MAP4K2, is a cytoplasm and peripheral membrane protein which belongs to the protein kinase superfamily, STE Ser/Thr protein kinase family and STE20 subfamily. MAP4K2 contains one CNH domain and one protein kinase domain. Although this kinase is found in many tissues, its expression in lymphoid follicles is restricted to the cells of germinal centre, where it may participate in B-cell differentiation. MAP4K2 can be activated by TNF-alpha, and has been shown to specifically activate MAP kinases. It is also found to interact with TNF receptor-associated factor 2 (TRAF2), which is involved in the activation of MAP3K1 / MEKK1. MAP4K2 enhances MAP3K1 oligomerization, which may relieve amino-terminal mediated MAP3K1 autoinhibition and lead to activation following autophosphorylation. It may also play a role in the regulation of vesicle targeting or fusion.

References
  • Katz P, et al.,1994, J Biol Chem 269 (24): 16802-9.
  • Ren, M; et al., 1996,  Proc. Natl. Acad. Sci. USA. 93 (10): 5151-5.
  • Chadee D.N., et al., 2002, Mol. Cell. Biol. 22:737-49.
  • Wissing J., et al., 2007, Mol. Cell. Proteomics 6:537-47.
  • Oppermann F.S., et al., 2009, Mol. Cell. Proteomics 8:1751-64.
  • Images
    • Human MAP4K2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"