After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human STXBP3 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human STXBP3 cDNA Clone Product Information
RefSeq ORF Size:1779bp
cDNA Description:Full length Clone DNA of Homo sapiens syntaxin binding protein 3.
Gene Synonym:PSP, MUNC18C, UNC-18C, MUNC18-3
Restriction Site:KpnI + XhoI (5.5kb + 1.78kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human STXBP3 natural ORF mammalian expression plasmid on other vectors
Product nameProduct name

Syntaxin-binding protein 3, also known as Platelet Sec1 protein, Protein unc-18 homolog 3, Protein unc-18 homolog C, Unc-18C, Unc18-3 and STXBP3, is a cytoplasm protein which belongs to the STXBP/unc-18/SEC1 family. STXBP3 is expressed in cells that exhibit granule exocytosis, such as neutrophils, mast cells, platelets and endothelial cells. STXBP3, together with STX4 and VAMP2, may play a role in insulin-dependent movement of GLUT4 and in docking / fusion of intracellular GLUT4-containing vesicles with the cell surface in adipocytes. STXBP3 participates in the consolidation and secretion of secondary and tertiary granules. STXBP3 contains one SEC1 domain. Phosphorylation at Ser129 may stimulate granule release. Human STXBP3 shares 90% aa identity with mouse STXBP3. STXBP3 interacts with DOC2B; the interaction is direct, occurs at the cell membrane, excludes interaction with STX4 and regulates glucose-stimulated insulin secretion. Interacts with STX4.

  • Kidd,M. et al., 2008, Am J Physiol Gastrointest Liver Physiol. 295 (2): G260-72.
  • Macedo,C. et al., 2008, Mol Cell Biochem. 318 (1-2): 63-71.
  • Size / Price
    Catalog: HG11823-G-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions