After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SERPINA12cDNA Clone Product Information
Gene_bank_ref_id:
cDNA Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
Background

Serpins are the largest and most diverse family of protease inhibitors. Most serpins control proteolytic cascades, certain serpins do not inhibit enzymes, but instead perform diverse functions such as storage (ovalbumin, in egg white), hormone carriage proteins (thyroxine-binding globulin, cortisol-binding globulin) and tumor suppressor genes (maspin). Most inhibitory serpins target chymotrypsin-like serine proteases. These enzymes are defined by the presence of a nucleophilic serine residue in their catalytic site. Some serpins inhibit other classes of protease. A number of such serpins have been shown to target cysteine proteases. These enzymes differ from serine proteases in that they are defined by the presence of a nucleophilic cysteine residue, rather than a serine residue, in their catalytic site.
SerpinA12, also known as OL-64, Visceral adipose tissue-derived serine protease inhibitor, Vaspin, Visceral adipose-specific serpin and SERPINA12, is a secreted protein which belongs to the serpin family. SerpinA12 / Vaspin is expressed in visceral adipose tissues. It may modulates insulin action conceivably only in the presence of its yet undefined target proteases in white adipose tissues. SerpinA12 / Vaspin may be the compensatory molecule in the pathogenesis of metabolic syndrome and SerpinA12 / Vaspin recombinant protein or vaspin-mimicking agents such as vaspin analogs, antibodies or small molecule agents may be the link to drug discovery and development.

References
  • Han X, et al., 1998, Proc Natl Acad Sci. USA. 95: 9250-5.
  • Han X, et al., 2000, Blood 96: 3049-55.
  • Irving JA, et al.,2000, Genome Res. 10 (12): 1845-64.
  • Irving J, et al.,2002, Mol Biol Evol. 19 (11): 1881-90.
  • Rawlings ND, et al.,2004, Biochem J. 378 (Pt 3): 705-16.
  • Water N, et al., 2004, Br J Haematol. 127:190-4.
  • Wei Z, et al., 2009, Blood 114 (17): 3662-7.
  • Whisstock JC, et al.,2010, J Biol Chem. 285 (32): 24307-12.
  • Size / Price
    Images
    • Human SERPINA12 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"