After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetReviewsRelated ProductsProtocols
Human KLK8 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human KLK8 Gene Plasmid Map
Human KLK8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Kallikrein-8, also known as Neuropsin, Serine protease 19, Serine protease TADG-14, Tumor-associated differentially expressed gene 14 protein and KLK8, is a secreted protein which belongs to the peptidase S1 family and Kallikrein subfamily. It is a serine protease which is capable of degrading a number of proteins such as casein, fibrinogen, kininogen, fibronectin and collagen type IV. Kallikrein-8 / KLK8 plays a role in the formation and maturation of orphan and small synaptic boutons in the Schaffer-collateral pathway. It regulates Schaffer-collateral long-term potentiation in the hippocampus and is required for memory acquisition and synaptic plasticity. It is involved in skin desquamation and keratinocyte proliferation and plays a role in the secondary phase of pathogenesis following spinal cord injury. It also cleaves L1CAM in response to increased neural activity. It induces neurite outgrowth and fasciculation of cultured hippocampal neurons. Kallikrein-8 / KLK8 is expressed at high levels in serum, ascites fluid and tumor cytosol of advanced stage ovarian cancer patients and may serve as a marker of ovarian cancer. Kallikrein-8 / KLK8 may have potential clinical value for disease diagnosis or prognosis and it may also be a useful therapeutic target.

  • Human KLK8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.