Quick Order

Mouse NDRG1 ORF mammalian expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse NDRG1 cDNA Clone Product Information
NCBI RefSeq:NM_008681.2
RefSeq ORF Size:1185bp
cDNA Description:Full length Clone DNA of Mus musculus N-myc downstream regulated gene 1 with C terminal HA tag.
Gene Synonym:RTP; DRG1; NMSL; Ndr1; Ndrl; TDD5; CAP43; CMT4D; HMSNL; PROXY1
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

NDRG1 gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. NDRG1 is a cytoplasmic protein involved in stress responses, hormone responses, cell growth, and differentiation. NDRG1 is necessary for p53-mediated caspase activation and apoptosis. Mutations in NDRG1 gene are a cause of Charcot-Marie-Tooth disease type 4D, and expression of this gene may be a prognostic indicator for several types of cancer. NDRG1 is a stress-responsive protein involved in hormone responses, cell growth, and differentiation. It acts as a tumor suppressor in many cell types.

References
  • Kachhap SK, et al. (2007) The N-Myc down regulated Gene1 (NDRG1) Is a Rab4a effector involved in vesicular recycling of E-cadherin. PLoS ONE. 2(9):e844.
  • Zhang J, et al. (2008) Human differentiation-related gene NDRG1 is a Myc downstream-regulated gene that is repressed by Myc on the core promoter region. Gene. 417(1-2):5-12.
  • Kokame K, et al. (1997) Homocysteine-respondent genes in vascular endothelial cells identified by differential display analysis. GRP78/BiP and novel genes. J Biol Chem. 271(47): 29659-65.
  • Size / Price
    Catalog: MG53154-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"