After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse PGD Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PGDcDNA Clone Product Information
cDNA Size:1452
cDNA Description:ORF Clone of Mus musculus phosphogluconate dehydrogenase DNA.
Gene Synonym:C78335; AU019875; 0610042A05Rik
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
  • Baillet A, et al. (2011) Coupling of 6-phosphogluconate dehydrogenase with NADPH oxidase in neutrophils: Nox2 activity regulation by NADPH availability. FASEB J. 25(7): 2333-43.
  • Rho HK, et al. (2005) Transcriptional regulation of mouse 6-phosphogluconate dehydrogenase by ADD1/SREBP1c. Biochem Biophys Res Commun. 332(1): 288-96.
  • Broedel SE, et al. (1990). Genetic tagging, cloning, and DNA sequence of the Synechococcus sp. strain PCC 7942 gene (gnd) encoding 6-phosphogluconate dehydrogenase. J Bacteriol. 172 (7): 4023-31.
  • Adams MJ, et al. (1983). The three dimensional structure of sheep liver 6-phosphogluconate dehydrogenase at 2.6 A resolution. EMBO J. 2 (6): 1009-14.