Quick Order

Text Size:AAA

Mouse CASQ1 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CASQ1 cDNA Clone Product Information
Gene_bank_ref_id:BC064057.1
RefSeq ORF Size:1200bp
cDNA Description:Full length Clone DNA of Mus musculus calsequestrin 1 with C terminal His tag.
Gene Synonym:CSQ; CSQ1; sCSQ; CSQ-1
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Calsequestrin-1 is an isoform of calsequestrin. Calsequestrin is a calcium-binding protein of the sarcoplasmic reticulum. It helps hold calcium in the cisterna of the sarcoplasmic reticulum after a muscle contraction, even though the concentration of calcium in the sarcoplasmic reticulum is much higher than in the cytosol. Two forms of calsequestrin have been identified: Calsequestrin-2 and Calsequestrin-1. Calsequestrin-1 is found in fast skeletal muscle. The release of calsequestrin-bound calcium (through a calcium release channel) triggers muscle contraction. The active protein is not highly structured, more than 50% of it adopting a random coil conformation. When calcium binds there is a structural change whereby the alpha-helical content of the protein increases from 3 to 11%. Both forms of calsequestrin are phosphorylated by casein kinase 2, but the cardiac form is phosphorylated more rapidly and to a higher degree. Calsequestrin-1 is also secreted in the gut where it deprives bacteria of calcium ions.

References
  • Slupsky JR, et al. (1987) Characterization of cardiac calsequestrin. Biochemistry. 26(20): 6539-44.
  • Cala SE, et al. (1991) Phosphorylation of cardiac and skeletal muscle calsequestrin isoforms by casein kinase II. Demonstration of a cluster of unique rapidly phosphorylated sites in cardiac calsequestrin. J Biol Chem. 266(1):391-8.
  • Wang S, et al. (1998) Crystal structure of calsequestrin from rabbit skeletal muscle sarcoplasmic reticulum. Nat Struct Biol. 5(6):476-83.
  • Size / Price
    Catalog: MG53155-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"