Quick Order

Text Size:AAA

Mouse NDRG1 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse NDRG1 cDNA Clone Product Information
NCBI RefSeq:NM_008681.2
RefSeq ORF Size:1185bp
cDNA Description:Full length Clone DNA of Mus musculus N-myc downstream regulated gene 1 with C terminal His tag.
Gene Synonym:RTP; DRG1; NMSL; Ndr1; Ndrl; TDD5; CAP43; CMT4D; HMSNL; PROXY1
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

NDRG1 gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. NDRG1 is a cytoplasmic protein involved in stress responses, hormone responses, cell growth, and differentiation. NDRG1 is necessary for p53-mediated caspase activation and apoptosis. Mutations in NDRG1 gene are a cause of Charcot-Marie-Tooth disease type 4D, and expression of this gene may be a prognostic indicator for several types of cancer. NDRG1 is a stress-responsive protein involved in hormone responses, cell growth, and differentiation. It acts as a tumor suppressor in many cell types.

References
  • Kachhap SK, et al. (2007) The N-Myc down regulated Gene1 (NDRG1) Is a Rab4a effector involved in vesicular recycling of E-cadherin. PLoS ONE. 2(9):e844.
  • Zhang J, et al. (2008) Human differentiation-related gene NDRG1 is a Myc downstream-regulated gene that is repressed by Myc on the core promoter region. Gene. 417(1-2):5-12.
  • Kokame K, et al. (1997) Homocysteine-respondent genes in vascular endothelial cells identified by differential display analysis. GRP78/BiP and novel genes. J Biol Chem. 271(47): 29659-65.
  • Size / Price
    Catalog: MG53154-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"