Quick Order

Mouse NDRG1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse NDRG1 cDNA Clone Product Information
Gene_bank_ref_id:NM_008681.2
RefSeq ORF Size:1185bp
cDNA Description:Full length Clone DNA of Mus musculus N-myc downstream regulated gene 1 with N terminal Myc tag.
Gene Synonym:RTP; DRG1; NMSL; Ndr1; Ndrl; TDD5; CAP43; CMT4D; HMSNL; PROXY1
Species:Mouse
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

NDRG1 gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. NDRG1 is a cytoplasmic protein involved in stress responses, hormone responses, cell growth, and differentiation. NDRG1 is necessary for p53-mediated caspase activation and apoptosis. Mutations in NDRG1 gene are a cause of Charcot-Marie-Tooth disease type 4D, and expression of this gene may be a prognostic indicator for several types of cancer. NDRG1 is a stress-responsive protein involved in hormone responses, cell growth, and differentiation. It acts as a tumor suppressor in many cell types.

References
  • Kachhap SK, et al. (2007) The N-Myc down regulated Gene1 (NDRG1) Is a Rab4a effector involved in vesicular recycling of E-cadherin. PLoS ONE. 2(9):e844.
  • Zhang J, et al. (2008) Human differentiation-related gene NDRG1 is a Myc downstream-regulated gene that is repressed by Myc on the core promoter region. Gene. 417(1-2):5-12.
  • Kokame K, et al. (1997) Homocysteine-respondent genes in vascular endothelial cells identified by differential display analysis. GRP78/BiP and novel genes. J Biol Chem. 271(47): 29659-65.
  • Size / Price
    Catalog: MG53154-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"