Quick Order

Mouse DNAJC30 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse DNAJC30 cDNA Clone Product Information
Gene_bank_ref_id:NM_025362.3
RefSeq ORF Size:660bp
cDNA Description:Full length Clone DNA of Mus musculus DnaJ (Hsp40) homolog, subfamily C, member 30.
Gene Synonym:Wbscr18; 1300007M11Rik
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

NAJC30 is a member of the DNAJ molecular chaperone homology domain-containing protein family. DNAJC30 gene is deleted in williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. DNAJC30 is expressed in brain, heart, kidney, liver, lung, spleen, stomach and testis. It contains 1 J domain. DNAJC30 is located in the Williams-Beuren syndrome (WBS) critical region. WBS results from a hemizygous deletion of several genes on chromosome 7q11.23, thought to arise as a consequence of unequal crossing over between highly homologous low-copy repeat sequences flanking the deleted region.

References
  • Hillier L W, et al. (2003) The DNA sequence of human chromosome 7. Nature. 424:157-164.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36:40-5.
  • Merla G, et al. (2002) Identification of additional transcripts in the Williams-Beuren syndrome critical region. Hum Genet. 110:429-38.
  • Size / Price
    Catalog: MG53163-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"