After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse DPEP1 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse DPEP1 cDNA Clone Product Information
NCBI RefSeq:NM_007876.2
RefSeq ORF Size:1233bp
cDNA Description:Full length Clone DNA of Mus musculus dipeptidase 1 (renal).
Gene Synonym:MBD; AI327012
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Dehydropeptidase-I, also known as DPEP1, is a kidney membrane enzyme. Its expression in normal colonic mucosa is very low, but it is highly expressed in colorectal adenoma and cancer specimens and is negatively correlated with parameters of pathological aggressiveness and poor prognosis. The overexpression of DPEP1 suppressed tumor cells invasiveness and increased sensitivity to chemotherapeutic agent Gemcitabine. Growth factor EGF treatment decreased DPEP1 expression. Dehydropeptidase-I may be a candidate target in PDAC for designing improved treatments. It uses zinc as a cofactor and acts as a disulfide-linked homodimer.

References
  • Toiyama Y. et al., 2011, J Gastroenterol. 46 (2): 153-63.
  • Zhang G. et al., 2012, PLoS One. 7 (2): e31507.
  • Okamoto T. et al., 2011, Mod Pathol. 24 (2): 267-76.
  • Size / Price
    Catalog: MG53160-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"