After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Cynomolgus monkey EPCAM Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
EPCAMcDNA Clone Product Information
cDNA Size:945
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) epithelial cell adhesion molecule DNA.
Gene Synonym:Ep-CAM; TACSTD1
Species:Cynomolgus monkey EPCAM Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Epithelial Cell Adhesion Molecule (EpCAM), also known as GA733-2 antigen, is a type â… transmembrane glycoprotein composed of an extracellular domain with two EGF-Like repeats and a cystenin-rich region, a transmembrane domain and a cytoplasmic domain. It modulates cell adhesion and proliferation. Its overexpression has been detected in many epithelial tumours and has been associated with high stage, high grade and a worse survival in some tumour types. EpCAM has been shown to function as a calcium-independent homophilic cell adhesion molecule that does not exhibit any obvious relationship to the four known cell adhesion molecule superfamilies. However, recent insights have revealed that EpCAM participates in not only cell adhesion, but also in proliferation, migration and differentiation of cells. In addition, recent study revealed that EpCAM is the Wnt-beta-catenin signaling target gene and may be used to facilitate prognosis. It has oncogenic potential and is activated by release of its intracellular domain, which can signal into the cell nucleus by engagement of elements of the wnt pathway.

  • Brunner A, et al. (2008) EpCAM is predominantly expressed in high grade and advanced stage urothelial carcinoma of the bladder. J Clin Pathol. 61(3):307-10.
  • Trzpis M, et al. (2008) EpCAM in morphogenesis. Front Biosci. 13: 5050-5.
  • Munz M, et al. (2009) The emerging role of EpCAM in cancer and stem cell signaling. Cancer Res. 69(14): 5627-9.
  • Carpenter G, et al. (2009) EpCAM: another surface-to-nucleus missile. Cancer Cell. 15(3): 165-6.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items