After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Cynomolgus monkey IL20RB Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL20RBcDNA Clone Product Information
cDNA Size:936
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) interleukin20receptorbeta DNA.
Gene Synonym:IL20RB
Species:Cynomolgus monkey IL20RB Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

IL-10 Family & Receptor Related Products

IL20RB belongs to the type II cytokine receptor family. There are two kinds of type II cytokine receptors : cytokine receptors that bind type I and type II interferons; cytokine receptors that bind members of the interleukin-10 family (interleukin-10, interleukin-20 and interleukin-22). Type II cytokine receptors are similar to type I cytokine receptors except they do not possess the signature sequence WSXWS that is characteristic of type I receptors. They are expressed on the surface of certain cells, which bind and respond to a select group of cytokines. These receptors are related predominantly by sequence similarities in their extracellular portions that are composed of tandem Ig-like domains. The intracellular domain of type II cytokine receptors is typically associated with a tyrosine kinase belonging to the Janus kinase (JAK) family. IL20RB and IL20RA (MIM 605620) form a heterodimeric receptor for interleukin-20.

  • Zhu H, et al. (2009) Expression pattern of mda-7/IL-24 receptors in liver cancer cell lines. Hepatobiliary Pancreat Dis Int. 8(4):402-6.
  • Logsdon NJ, et al. (2012) Purification, crystallization and preliminary X-ray diffraction analysis of the IL-20-IL-20R1-IL-20R2 complex. Acta Crystallogr Sect F Struct Biol Cryst Commun. 68(Pt 1):89-92.
  • Kingo K, et al. (2008) Association analysis of IL20RA and IL20RB genes in psoriasis. Genes Immun. 9(5):445-51.