Quick Order

Marmoset IL23A ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Marmoset IL23A cDNA Clone Product Information
NCBI RefSeq:XM_002752608.1
RefSeq ORF Size:570bp
cDNA Description:Full length Clone DNA of Callithrix jacchus (white-tufted-ear marmoset) interleukin 23, alpha subunit p19 with C terminal Myc tag.
Gene Synonym:IL23A
Species:Marmoset
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Human IL-12 Protein (IL12A & IL12B Heterodimer) Protein (His Tag)Rat IL23R / IL23 Receptor Protein (ECD, His Tag)Rabbit IL12B / IL-12B Protein (His Tag)Human IL6ST / gp130 / CD130 Protein (ECD, Fc Tag)Human IL-23 (IL12B & IL23A Heterodimer) Protein (His Tag)Rat IL12B / IL-12B Protein (Fc Tag)Human IL23A & Mouse IL12B Heterodimer Protein (His Tag)Human IL12A / NKSF1 Protein (Fc Tag)Human IL12B / P40 Protein (Fc Tag)Human IL27Ra / TCCR / WSX1 Protein (Fc Tag)Human IL-35 (IL12A & IL27B) Protein (Fc Tag)Human IL12B / P40 Protein (His Tag)Human IL6ST / gp130 / CD130 Protein (His & Fc Tag)Mouse IL6ST / CD130 Protein (His & Fc Tag)Human IL12A / NKSF1 Protein (His Tag)Human IL12RB1 / IL12RB / CD212 Protein (His Tag)Mouse IL12RB2 / IL12R-beta 2 Protein (His Tag)Mouse IL6ST / gp130 / CD130 Protein (His Tag)Rat gp130 / IL6ST / CD130 Protein (His & Fc Tag)Human IL-12 (IL12A & IL12B Heterodimer) ProteinHuman IL-23 (IL23A & IL12B Heterodimer) ProteinRat gp130 / IL6ST / CD130 Protein (His Tag)Mouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL12B / IL-12B Protein (Fc Tag)Rat IL-23 (IL23A & IL12B Heterodimer) ProteinMouse IL6ST / gp130 / CD130 Protein (His & Fc Tag)Cynomolgus / Rhesus IL23R / IL23 Receptor Protein (Fc Tag)Human IL27 / Interleukin-27 Protein (His Tag)Mouse IL27 / Interleukin-27 Protein (His Tag)Mouse IL12B / IL-12B Protein (His Tag)Rat IL23R / IL23 Receptor Protein (Fc Tag)Human IL23R / IL23 Receptor Protein (Fc Tag)Rat IL12B / IL-12B Protein (His Tag)Mouse IL12B / IL-12B ProteinMouse IL-23 (IL23A & IL12B Heterodimer) ProteinMarmoset IL12B / IL-12B Protein (Fc Tag)Rhesus IL6ST / gp130 Protein (Fc Tag)Marmoset IL-23 (IL23A & IL12B Heterodimer) ProteinRhesus IL-12 (IL12A & IL12B Heterodimer) ProteinRhesus IL6ST / gp130 Protein (His Tag)Human IL6ST / gp130 / CD130 ProteinHuman IL12A & IL27B Heterodimer ProteinRhesus IL12A / NKSF1 Protein (Fc Tag)
Size / Price
Catalog: CG90288-CM
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"