After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Cynomolgus monkey VEGFA transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
VEGFAcDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
cDNA Size:576
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) vascular endothelial growth factor A transcript variant 2 DNA.
Gene Synonym:VEGFA
Species:Cynomolgus monkey VEGFA transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged
Vector:pCMV3-N-FLAG
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Cynomolgus monkey VEGFA transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged on other vectors
Vascular Endothelial Growth Factor (VEGF) & Receptor Related Products
Product nameProduct name
Cynomolgus Neuropilin-1 / NRP1 Protein (Fc Tag)Cynomolgus Neuropilin-1 / NRP1 ProteinHuman VEGFR1 / FLT-1 Protein (Fc Tag)Human PIGF / PLGF Protein (Fc Tag)Cynomolgus Neuropilin-1 / NRP1 / CD304 Protein (His Tag)Human VEGF121 / VEGF-A ProteinHuman Neuropilin-1 / NRP1 Protein (Fc Tag)Human Neuropilin-1 / NRP1 / CD304 Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His & GST Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human VEGF-C Protein (His Tag)Human VEGF-D / VEGFD / FIGF Protein (His Tag)Human Neuropilin 2 / NRP2 Protein (Fc Tag)Human Neuropilin-2 / NRP2 Protein (His Tag)Human VEGFR3 / FLT4 Protein (Fc Tag)Human VEGFR3 / FLT4 Protein (His Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human / Cynomolgus VEGF / VEGFA / VEGF165 ProteinHuman / Cynomolgus VEGF / VEGFA / VEGF165 ProteinHuman VEGF121 / VEGF-A ProteinHuman VEGF121b / VEGF-A ProteinMouse PIGF / PLGF Protein (Fc Tag)Mouse PIGF / PLGF ProteinMouse VEGF-D / VEGFD / FIGF Protein (Fc Tag)Mouse VEGF-D / VEGFD / FIGF Protein (His Tag)Mouse VEGFA / VEGF164 ProteinMouse VEGFR3 / FLT-4 Protein (Fc Tag)Mouse VEGFR3 / FLT-4 Protein (His Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Danio rerio (zebrafish) VEGF / VEGFA / VEGF165 ProteinCanine VEGF / VEGFA ProteinRat VEGF164 / VEGFA ProteinRat VEGFR1 / FLT-1 Protein (His Tag)Rat VEGFC / VEGF-C Protein (aa 108-223, Fc Tag)Rat VEGFC / VEGF-C Protein (aa 108-223, His Tag)Rat VEGF-D / VEGFD / FIGF Protein (Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)

Vascular endothelial growth factor (VEGF), also known as vascular permeability factor (VPF) and VEGF-A, is a potent mediator of both angiogenesis and vasculogenesis in the fetus and adult. It is a member of the platelet-derived growth factor (PDGF)/vascular endothelial growth factor (VEGF) family and often exists as a disulfide-linked homodimer. VEGF-A protein is a glycosylated mitogen that specifically acts on endothelial cells and has various effects, including mediating increased vascular permeability, inducing angiogenesis, vasculogenesis and endothelial cell growth, promoting cell migration, inhibiting apoptosis and tumor growth. VEGF-A protein is also a vasodilator that increases microvascular permeability, thus it was originally referred to as vascular permeability factor.

Reference
  • Woolard J. et al. (2004) VEGF165b, an inhibitory vascular endothelial growth factor splice variant: mechanism of action, in vivo effect on angiogenesis and endogenous protein expression. Cancer Res. 64(21): 7822-7835.
  • Jia SF, et al. (2008) VEGF165 is necessary to the metastatic potential of Fas(-) osteosarcoma cells but will not rescue the Fas(+) cells. J Exp Ther Oncol. 7(2): 89-97.
  • Cimpean AM, et al. (2008) Vascular endothelial growth factor A (VEGF A) as individual prognostic factor in invasive breast carcinoma. Rom J Morphol Embryol. 49(3): 303-8.
  • Hamdollah Zadeh MA, et al. (2008) VEGF-mediated elevated intracellular calcium and angiogenesis in human microvascular endothelial cells in vitro are inhibited by dominant negative TRPC6. Microcirculation. 15(7): 605-14.
  • Eisenach PA, et al. (2010) MT1-MMP regulates VEGF-A expression through a complex with VEGFR-2 and Src. J Cell Sci. 123(Pt 23):4182-4193.
  • Claesson-Welsh L (2010) Gremlin: vexing VEGF receptor agonist. Blood. 116(18):3386-7.
  • Size / Price
    Catalog:CG90326-NF
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availsability:2-3 weeks
    Images
      Please note:All products are "FOR RESEARCH UES ONLY AND ARE NOT INTENDED FOR DIAGNOSTICE OFR THERAPEUTIC USE"