After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Cynomolgus monkey IL9R natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus IL9R cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
RefSeq ORF Size:1545bp
cDNA Description:Full length Clone DNA of Macaca mulatta interleukin 9 receptor.
Gene Synonym:IL9R
Species:Cynomolgus
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
References
  • Demoulin JB. et al. (1998) Interleukin 9 and its receptor: an overview of structure and function. Int Rev Immunol. 16 (3-4): 345-64.
  • Sliva D. et al. (1999) Tip60 interacts with human interleukin-9 receptor alpha-chain. Biochem Biophys Res Commun. 263 (1): 149-55.
  • Renauld JC. et al. (1995) Interleukin-9 and its receptor: involvement in mast cell differentiation and T cell oncogenesis. J Leukoc Biol. 57 (3): 353-60.
  • Size / Price
    Catalog: CG90327-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"