Quick Order

Rhesus IL20RB natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus IL20RB cDNA Clone Product Information
Gene_bank_ref_id:NM_001194658.1
RefSeq ORF Size:936bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) interleukin20receptorbeta.
Gene Synonym:IL20RB
Species:Rhesus
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Background

IL20RB belongs to the type II cytokine receptor family. There are two kinds of type II cytokine receptors : cytokine receptors that bind type I and type II interferons; cytokine receptors that bind members of the interleukin-10 family (interleukin-10, interleukin-20 and interleukin-22). Type II cytokine receptors are similar to type I cytokine receptors except they do not possess the signature sequence WSXWS that is characteristic of type I receptors. They are expressed on the surface of certain cells, which bind and respond to a select group of cytokines. These receptors are related predominantly by sequence similarities in their extracellular portions that are composed of tandem Ig-like domains. The intracellular domain of type II cytokine receptors is typically associated with a tyrosine kinase belonging to the Janus kinase (JAK) family. IL20RB and IL20RA (MIM 605620) form a heterodimeric receptor for interleukin-20.

References
  • Zhu H, et al. (2009) Expression pattern of mda-7/IL-24 receptors in liver cancer cell lines. Hepatobiliary Pancreat Dis Int. 8(4):402-6.
  • Logsdon NJ, et al. (2012) Purification, crystallization and preliminary X-ray diffraction analysis of the IL-20-IL-20R1-IL-20R2 complex. Acta Crystallogr Sect F Struct Biol Cryst Commun. 68(Pt 1):89-92.
  • Kingo K, et al. (2008) Association analysis of IL20RA and IL20RB genes in psoriasis. Genes Immun. 9(5):445-51.
  • Size / Price
    Catalog: CG90308-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"