After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Cynomolgus monkey IL5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL5cDNA Clone Product Information
cDNA Size:405
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) interleukin5 DNA.
Gene Synonym:IL5
Species:Cynomolgus monkey IL5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Other Interleukin & Receptor Related Products
Product nameProduct name
Mouse CD122 / IL2RB / IL2 Receptor beta Protein (His Tag)Canine IL3RA Protein (His Tag)Canine IL2RB / IL2 Receptor beta Protein (Fc Tag)Human IL-15 / IL15 / Interleukin 15 Protein (His Tag)Mouse CD123 / IL3RA Protein (ECD, Fc Tag)Human IL3 / IL-3 Protein (His Tag)Cynomolgus / Rhesus IL21R / IL-21R Protein (Fc Tag)Human IL3 / IL-3 ProteinMouse IL-21R / Il21R Protein (ECD, His Tag)Rat IL9 / IL-9 Protein (His Tag)Human IL-8 / CXCL8 Protein (aa 28-99)Human IL-8 / CXCL8 Protein (aa 23-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 28-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 23-99)Human IL-8 / CXCL8 Protein (aa 28-99)Human IL2Ra / CD25 Protein (Fc Tag)Human IL2Ra / CD25 Protein (His Tag)Human IL13RA2 / IL13R Protein (His & Fc Tag)Human IL13RA2 / CD213A2 Protein (His Tag)Human IL13 / ALRH Protein (Fc Tag)Human IL13 / ALRH ProteinHuman IL5Ra / CD125 Protein (His Tag)Human IL4R / CD124 Protein (His Tag)Human CD131 / CSF2RB / IL3RB / IL5RB Protein (His Tag)Human IL3RA / CD123 Protein (His & Fc Tag)Human IL3RA / CD123 Protein (His Tag)Mouse CD123 / IL3RA Protein (ECD, His Tag)Human IL2RG / CD132 Protein (Fc Tag)Human IL2RG / CD132 Protein (His Tag)Human CD122 / IL-2RB Protein (Fc Tag)Human CD122 / IL-2RB ProteinHuman IL13RA1 Protein (His & Fc Tag)Human IL13RA1 Protein (His Tag)Human IL16 / Interleukin-16 Protein (His Tag)Human IL7RA / CD127 Protein (His & Fc Tag)Cynomolgus CD127 / IL-7RA Protein (His Tag)Human IL7RA / CD127 Protein (His Tag)Cynomolgus IL13 / ALRH Protein (His Tag)Cynomolgus IL13 / ALRH ProteinHuman Interleukin-32 / IL-32 Protein (isoform alpha, His Tag)Human IL-21R / Interleukin-21 Receptor Protein (His Tag)Human IL-9 / Interleukin-9 Protein (His Tag)Human IL4 / Interleukin-4 ProteinHuman Interleukin-2 / IL-2 ProteinHuman IL-3 / Interleukin-3 Protein (His Tag)Mouse IL-4R / CD124 Protein (ECD, His Tag)Mouse IL4 / Interleukin-4 ProteinMouse IL-34 Protein (His Tag)Mouse IL13RA2 / CD213A2 Protein (His & Fc Tag)Mouse IL13RA2 / CD213A2 Protein (His Tag)Mouse IL2RG Protein (His & Fc Tag)Mouse IL2RG / CD132 Protein (His Tag)Mouse IL-13Ra1 Protein (His & Fc Tag)Mouse IL13RA1 Protein (His Tag)Mouse IL7RA / CD127 Protein (His Tag)Mouse IL13 / ALRH ProteinMouse IL2RA / CD25 Protein (His Tag)Mouse Interleukin-2 / IL-2 ProteinMouse IL5 Protein (His Tag)Mouse IL4 / Interleukin-4 Protein (Q136D, Y139D, His Tag)Mouse IL5Ra / CD125 Protein (His Tag)Canine IL-8 / CXCL8 ProteinCanine Interleukin-2 / IL-2 Protein (147 Cys/Ser)Canine IL5 Protein (His Tag)Canine IL4 / Interleukin-4 ProteinCanine IL13RA2 / IL13R Protein (His Tag)Human IL5 / Interleukin 5 ProteinRat Interleukin-2 / IL-2 ProteinRat IL7R / IL7RA Protein (Fc Tag)Rat IL7R / IL7RA Protein (His Tag)Rat IL13RA1 Protein (Fc Tag) Rat IL-21R / Interleukin-21 Receptor Protein (His Tag)Rat IL2RG / CD132 Protein (Fc Tag)Rat IL2RG / CD132 Protein (His Tag)Rat IL4R / Il4ra Protein (Fc Tag)Rat IL4R / Il4ra Protein (His Tag)Rat IL13RA2 / IL13R Protein (Fc Tag)Rat IL13RA2 / IL13R Protein (His Tag)Rat IL3 / interleukin 3 Protein (His Tag)Rat CD131 / CSF2RB / IL3RB / IL5RB Protein (Fc Tag)Human IL2 / Interleukin-2 Protein (L35M, L36S, C142A)Cynomolgus IL-21R / Interleukin-21 Receptor Protein (His Tag)Cynomolgus IL2RA Protein (Fc Tag)Cynomolgus IL2RA Protein (His Tag)Cynomolgus IL2RA ProteinCynomolgus IL-8 / CXCL8 ProteinMouse IL16 / Interleukin-16 Protein (His Tag)Canine IL13RA2 / IL13R Protein (Fc Tag)

Interleukin 5 (IL-5) is a member of the interleukin family with length of 115 amino acids. Interleukins are a group of cytokines (secreted proteins / signaling molecules) that were first seen to be expressed by white blood cells (leukocytes) and has been found in a wide variety of body cells. Interleukin 5 or IL-5 is produced by T helper-2 cells and mast cells. It helps to stimulate B cell growth and increase immunoglobulin secretion and is considered as a key mediator in eosinophil activation. Interleukin 5 (IL-5) has long been associated with several allergic diseases, including allergic rhinitis and asthma. Growth in the number of circulating, airway tissue, and induced sputum eosinophils have been observed in patients with these diseases. IL-5 also had something with the terminally differentiated granulocyte eosinophils. IL-5 was originally found as an eosinophil colony stimulating factor. It has been proved to be a major regulator of eosinophil accumulation in tissues, and can modulate eosinophil behavior at every stage from maturation to survival.

  • Milburn MV, et al. (1993) A novel dimer configuration revealed by the crystal structure at 2.4 A resolution of human interleukin-5. Nature. 363(6425): 172-176.
  • Lee JS, et al. (1989) The IL-4 and IL-5 genes are closely linked and are part of a cytokine gene cluster on mouse chromosome 11. Somat Cell Mol Genet. 15(2): 143-152.
  • Woodcock JM, et al. (1994) Three residues in the common beta chain of the human GM-CSF, IL-3 and IL-5 receptors are essential for GM-CSF and IL-5 but not IL-3 high affinity binding and interact with Glu21 of GM-CSF. EMBO J. 13 (21): 5176-85.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items