Quick Order

Text Size:AAA

Enterovirus D68 (EV-D68) (strain Fermon) P1 / capsid protein natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
EV-D68 EV-D68 P1 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:2583bp
cDNA Description:Full length Clone DNA of Enterovirus D68 (EV-D68) (strain Fermon) P1.
Gene Synonym:EV-D68 P1
Species:EV-D68
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AY426531.1 (nt 733-3315).
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Enterovirus D68 (EV-D68) (strain Fermon) P1 / capsid protein natural ORF mammalian expression plasmid on other vectors
Product nameProduct name
Size / Price
Catalog: VG40467-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"