After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Dromedary camel coronavirus (DcCoV) (strain HKU23-368F) Spike protein natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DcCoV DcCoV-Spike cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:4101bp
cDNA Description:Full length Clone DNA of Dromedary camel coronavirus (DcCoV) (strain HKU23-368F) Spike protein (S).
Gene Synonym:DcCoV-Spike
Species:DcCoV
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with KF906251.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Dromedary camel coronavirus (DcCoV) (strain HKU23-368F) Spike protein natural ORF mammalian expression plasmid on other vectors
Dromedary camel coronavirus (DcCoV) (strain HKU23-368F) Spike protein ORF mammalian expression plasmid, C-GFPSpark tagVG40457-ACG$475
Dromedary camel coronavirus (DcCoV) (strain HKU23-368F) Spike protein ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40457-ACR$475
Dromedary camel coronavirus (DcCoV) (strain HKU23-368F) Spike protein ORF mammalian expression plasmid, C-Flag tagVG40457-CF$445
Dromedary camel coronavirus (DcCoV) (strain HKU23-368F) Spike protein ORF mammalian expression plasmid, C-His tagVG40457-CH$445
Dromedary camel coronavirus (DcCoV) (strain HKU23-368F) Spike protein ORF mammalian expression plasmid, C-Myc tagVG40457-CM$445
Dromedary camel coronavirus (DcCoV) (strain HKU23-368F) Spike protein ORF mammalian expression plasmid, C-HA tagVG40457-CY$445
Dromedary camel coronavirus (DcCoV) (strain HKU23-368F) Spike protein ORF mammalian expression plasmid (Codon Optimized)VG40457-G$195
Dromedary camel coronavirus (DcCoV) (strain HKU23-368F) Spike protein ORF mammalian expression plasmid, N-Flag tagVG40457-NF$445
Dromedary camel coronavirus (DcCoV) (strain HKU23-368F) Spike protein ORF mammalian expression plasmid, N-His tagVG40457-NH$445
Dromedary camel coronavirus (DcCoV) (strain HKU23-368F) Spike protein ORF mammalian expression plasmid, N-Myc tagVG40457-NM$445
Dromedary camel coronavirus (DcCoV) (strain HKU23-368F) Spike protein ORF mammalian expression plasmid, N-HA tagVG40457-NY$445
Dromedary camel coronavirus (DcCoV) (strain HKU23-368F) Spike protein natural ORF mammalian expression plasmidVG40457-UT$445
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40457-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"