After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
cDNA Clone Product Information
Gene_bank_ref_id:
cDNA Size:756
cDNA Description:ORF Clone of Ebola virus EBOV (subtype Sudan, strain Gulu) membrane-associated protein VP24 DNA.
Gene Synonym:EBOV-VP24
Species:EBOV
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedVG40455-ACG$325
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagVG40455-ACR$325
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedVG40455-ANG$325
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagVG40455-ANR$325
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40455-CF$295
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedVG40455-CH$295
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedVG40455-CM$295
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedVG40455-CY$295
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone)VG40455-G$95
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedVG40455-NF$295
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedVG40455-NH$295
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedVG40455-NM$295
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedVG40455-NY$295
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedVG40455-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"