Quick Order

Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
cDNA Clone Product Information
Gene_bank_ref_id:
cDNA Size:756
cDNA Description:ORF Clone of Ebola virus EBOV (subtype Sudan, strain Gulu) membrane-associated protein VP24 DNA.
Gene Synonym:EBOV-VP24
Species:EBOV
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedVG40455-ACG$325
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagVG40455-ACR$325
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedVG40455-ANG$325
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagVG40455-ANR$325
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40455-CF$295
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedVG40455-CH$295
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedVG40455-CM$295
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedVG40455-CY$295
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone)VG40455-G$95
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedVG40455-NF$295
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedVG40455-NH$295
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedVG40455-NM$295
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedVG40455-NY$295
Ebola virus EBOV (subtype Sudan, strain Gulu) VP24 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedVG40455-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"