Quick Order

Text Size:AAA

Ebola virus EBOV (subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) VP24 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
EBOV  cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:756bp
cDNA Description:Full length Clone DNA of Ebola virus EBOV (subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) membrane-associated protein VP24.
Gene Synonym:EBOV-VP24
Species:EBOV
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with KJ660346.1 (nt 10345-11100).
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Ebola virus EBOV (subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) VP24 natural ORF mammalian expression plasmid on other vectors
Ebola virus EBOV (subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) VP24 ORF mammalian expression plasmid, C-GFPSpark tagVG40454-ACG$325
Ebola virus EBOV (subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) VP24 ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40454-ACR$325
Ebola virus EBOV (subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) VP24 ORF mammalian expression plasmid, N-GFPSpark tagVG40454-ANG$325
Ebola virus EBOV (subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) VP24 ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40454-ANR$325
Ebola virus EBOV (subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) VP24 ORF mammalian expression plasmid, C-Flag tagVG40454-CF$295
Ebola virus EBOV (subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) VP24 ORF mammalian expression plasmid, C-His tagVG40454-CH$295
Ebola virus EBOV (subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) VP24 ORF mammalian expression plasmid, C-Myc tagVG40454-CM$295
Ebola virus EBOV (subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) VP24 ORF mammalian expression plasmid, C-HA tagVG40454-CY$295
埃博拉病毒 (EBOV) (subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) VP24 基因全长ORF克隆VG40454-G$95
Ebola virus EBOV (subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) VP24 ORF mammalian expression plasmid, N-Flag tagVG40454-NF$295
Ebola virus EBOV (subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) VP24 ORF mammalian expression plasmid, N-His tagVG40454-NH$295
Ebola virus EBOV (subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) VP24 ORF mammalian expression plasmid, N-Myc tagVG40454-NM$295
Ebola virus EBOV (subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) VP24 ORF mammalian expression plasmid, N-HA tagVG40454-NY$295
Ebola virus EBOV (subtype Zaire, strain H.sapiens-wt/GIN/2014/Kissidougou-C15) VP24 natural ORF mammalian expression plasmidVG40454-UT$295
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40454-UT
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"