Quick Order

Text Size:AAA

Dengue virus 1 DENV-1 (strain Hawaii) capsid protein Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DENV-CcDNA Clone Product Information
cDNA Size:342
cDNA Description:ORF Clone of Dengue virus DENV-2 (strain Hawaii) capsid protein C DNA.
Gene Synonym:DENV-C
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Dengue virus 1 DENV-1 (strain Hawaii) capsid protein Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Dengue virus 1 DENV-1 (strain Hawaii) capsid protein Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedVG40451-ACG$325
Dengue virus 1 DENV-1 (strain Hawaii) capsid protein Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagVG40451-ACR$325
Dengue virus 1 DENV-1 (strain Hawaii) capsid protein Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40451-CF$295
Dengue virus 1 DENV-1 (strain Hawaii) capsid protein Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedVG40451-CH$295
Dengue virus 1 DENV-1 (strain Hawaii) capsid protein Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedVG40451-CM$295
Dengue virus 1 DENV-1 (strain Hawaii) capsid protein Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedVG40451-CY$295
Dengue virus 1 DENV-1 (strain Hawaii) capsid protein Gene cDNA Clone (full-length ORF Clone)VG40451-G$95
Dengue virus 1 DENV-1 (strain Hawaii) capsid protein Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedVG40451-NF$295
Dengue virus 1 DENV-1 (strain Hawaii) capsid protein Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedVG40451-NH$295
Dengue virus 1 DENV-1 (strain Hawaii) capsid protein Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedVG40451-NM$295
Dengue virus 1 DENV-1 (strain Hawaii) capsid protein Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedVG40451-NY$295
Dengue virus 1 DENV-1 (strain Hawaii) capsid protein Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedVG40451-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name