After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Chikungunya virus (CHIKV) (strain SL-CK1) E1 glycoprotein Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
CHIKV-E1cDNA Clone Product Information
Gene Bank Ref.ID:
cDNA Size:1323
cDNA Description:ORF Clone of Chikungunya virus (CHIKV), strain SL-CK1 glycoprotein E1 DNA.
Gene Synonym:CHIKV-E1
Species:CHIKV
Vector:pCMV3-untagged
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-untagged Vector Information
 
Vector Name pCMV3-untagged
Vector Size 6223bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-untagged Physical Map

Schematic of pCMV3-untagged Multiple Cloning Sites
Chikungunya virus (CHIKV) (strain SL-CK1) E1 glycoprotein Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Chikungunya virus (CHIKV) (strain SL-CK1) E1 glycoprotein Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedVG40441-ACG$325
Chikungunya virus (CHIKV) (strain SL-CK1) E1 glycoprotein Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedVG40441-ANG$325
Chikungunya virus (CHIKV) (strain SL-CK1) E1 glycoprotein Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40441-CF$295
Chikungunya virus (CHIKV) (strain SL-CK1) E1 glycoprotein Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedVG40441-CH$295
Chikungunya virus (CHIKV) (strain SL-CK1) E1 glycoprotein Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedVG40441-CM$295
Chikungunya virus (CHIKV) (strain SL-CK1) E1 glycoprotein Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedVG40441-CY$295
Chikungunya virus (CHIKV) (strain SL-CK1) E1 glycoprotein Gene cDNA Clone (full-length ORF Clone)VG40441-G$95
Chikungunya virus (CHIKV) (strain SL-CK1) E1 glycoprotein Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedVG40441-NF$295
Chikungunya virus (CHIKV) (strain SL-CK1) E1 glycoprotein Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedVG40441-NH$295
Chikungunya virus (CHIKV) (strain SL-CK1) E1 glycoprotein Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedVG40441-NM$295
Chikungunya virus (CHIKV) (strain SL-CK1) E1 glycoprotein Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedVG40441-NY$295
Chikungunya virus (CHIKV) (strain SL-CK1) E1 glycoprotein Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedVG40441-UT$295
 
Related Products
Product nameProduct name
Size / Price
Catalog:VG40441-UT
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availsability:2-3 weeks
Images
    Please note:All products are "FOR RESEARCH UES ONLY AND ARE NOT INTENDED FOR DIAGNOSTICE OFR THERAPEUTIC USE"