After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rat MBL2 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat MBL2 cDNA Clone Product Information
Gene_bank_ref_id:NM_022704.2
RefSeq ORF Size:735bp
cDNA Description:Full length Clone DNA of Rattus norvegicus mannose-binding lectin (protein C) 2 with N terminal HA tag.
Gene Synonym:Ab2-001; Ab2-011
Species:Rat
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

MBL (mannose-binding lectin) is primarily a liver-derived collagen-like serum protein, which binds sugar structures on micro-organisms and on dying host cells and is one of the four known mediators that initiate activation of the complement system via the lectin pathway. MBL and the ficolins (Ficolin-1, Ficolin-2 and Ficolin-3) are soluble collagen-like proteins that are involved in innate immune defence. They bind sugar structures or acetylated compounds present on microorganisms and on dying host cells and they initiate activation of the lectin complement pathway in varying degrees. MBL2 encodes the mannose-binding lectin, which is a key player in the innate immune system and has recently been found to play a role in development of type 1 diabetes and gestational diabetes mellitus. Common variant alleles situated both in promoter and structural regions of the MBL2 gene influence the stability and the serum concentration of the protein. Several polymorphisms in the promoter and structural regions of MBL2 adversely affect the plasma concentration and oligomeric state of MBL. The possession of mutant alleles has been linked to disease outcome for a variety of bacterial and viral infections. Mutant MBL2 haplotypes have been linked to disease progression and response to therapy in HCV infection.

References
  • Garred P, et al. (2006) Mannose-binding lectin and its genetic variants. Genes Immun. 7(2): 85-94.
  • Brown KS, et al. (2007) Mannan binding lectin and viral hepatitis. Immunol Lett. 108(1): 34-44.
  • Garred P. (2008) Mannose-binding lectin genetics: from A to Z. Biochem Soc Trans. 36(Pt 6): 1461-6.
  • Garred P, et al. (2009) MBL2, FCN1, FCN2 and FCN3-The genes behind the initiation of the lectin pathway of complement. Mol Immunol. 46(14): 2737-44.
  • Muller YL, et al. (2010) Functional Variants in MBL2 Are Associated With Type 2 Diabetes and Pre-Diabetes Traits in Pima Indians and the Old Order Amish. Diabetes. 59(8): 2080-5.
  • Size / Price
    Catalog: RG81661-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"