Quick Order

Mouse CANX ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CANX cDNA Clone Product Information
NCBI RefSeq:NM_007597.3
RefSeq ORF Size:1776bp
cDNA Description:Full length Clone DNA of Mus musculus calnexin with N terminal HA tag.
Gene Synonym:Cnx; AI988026; D11Ertd153e; 1110069N15Rik
Species:Mouse
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Calnexin is a calcium-binding protein that belongs to the calreticulin family. It interacts with newly synthesized glycoproteins in the endoplasmic reticulum. Calnexin seems to play a major role in the quality control apparatus of the ER by the retention of incorrectly folded proteins. It may act in assisting protein assembly and/or in the retention within the ER of unassembled protein subunits. Associated with partial T-cell antigen receptor complexes that escape the ER of immature thymocytes, it may function as a signaling complex regulating thymocyte maturation. Additionally it may play a role in receptor-mediated endocytosis at the synapse.

References
  • Rajagopalan S, et al. (1994) Retention of unassembled components of integral membrane proteins by Calnexin(CANX). Science. 263(5145):387-90.
  • Lenter M, et al. (1994) The integrin chains beta 1 and alpha 6 associate with the chaperone Calnexin(CANX) prior to integrin assembly. J Biol Chem. 269(16):12263-8.
  • Pind S, et al. (1994) Retention of unassembled components of integral membrane proteins by Calnexin(CANX). Science. 263(5145):387-90.
  • Size / Price
    Catalog: MG53126-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"