Quick Order

Mouse CNPY4 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CNPY4 cDNA Clone Product Information
Gene_bank_ref_id:NM_178612.4
RefSeq ORF Size:738bp
cDNA Description:Full length Clone DNA of Mus musculus canopy 4 homolog (zebrafish) with N terminal HA tag.
Gene Synonym:2610019P18Rik
Species:Mouse
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

CNPY4 belongs to the canopy family. CNPY4 interacts with toll-like receptor 4 (TLR4) and plays a role in the regulation of the cell surface expression of TLR4. Toll-like receptors (TLRs) recognize microbial products and induce immune responses. Lipopolysaccharide is recognized by the receptor complex consisting of TLR4 and MD-2. As CNPY4, PRAT4B also regulates cell surface expression of TLR4. PRAT4B has a signal peptide followed by a mature peptide. It is associated with the hypoglycosylated, immature form of TLR4 but not with MD-2 or TLR2.

References
  • Stelzl U, et al. (2005) A human protein-protein interaction network: a resource for annotating the proteome. Cell. 122(6):957-68.
  • Hocking JC, et al. (2010) Distinct roles for Robo2 in the regulation of axon and dendrite growth by retinal ganglion cells. Mech Dev. 127(1-2):36-48.
  • Hart BE, et al. (2012) Cell surface trafficking of TLR1 is differentially regulated by the chaperones PRAT4A and PRAT4B. J Biol Chem. 287(20):16550-62.
  • Size / Price
    Catalog: MG53099-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"