After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse RPRD1B ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse RPRD1B cDNA Clone Product Information
Gene_bank_ref_id:XM_006500163.1
RefSeq ORF Size:663bp
cDNA Description:Full length Clone DNA of Mus musculus regulation of nuclear pre-mRNA domain containing 1B with N terminal HA tag.
Gene Synonym:Crept; 2610304G08Rik; 2810446G03Rik
Species:Mouse
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

RPRD1B, together with RPRD1A, can accompany RNAP II from promoter regions to 3'-untranslated regions during transcription in vivo, predominantly interact with phosphorylated RNAP II, and can reduce CTD S5- and S7-phosphorylated RNAP II at target gene promoters. RNA polymerase II C-terminal domain (CTD) phosphorylation is important for various transcription-related processes. RPRD1B is a transcriptional regulator which enhances expression of CCND1. It also enhances the transcription of a number of other cell cycle-related genes including CDK2, CDK4, CDK6 and cyclin-E but not CDKN1A, CDKN1B or cyclin-A.

References
  • Ni Z. et al., 2011, Transcription. 2 (5): 237-42.
  • Kristensen AR. et al., 2012, Nat Methods. 9 (9): 907-9.
  • Woods NT. et al., 2012, Sci Signal.5 (242): rs6.
  • Size / Price
    Catalog: MG53089-NY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"