Quick Order

Text Size:AAA

Mouse RPRD1B Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RPRD1BcDNA Clone Product Information
Gene_bank_ref_id:XM_006500163.1
cDNA Size:663
cDNA Description:ORF Clone of Mus musculus regulation of nuclear pre-mRNA domain containing 1B DNA.
Gene Synonym:Crept; 2610304G08Rik; 2810446G03Rik
Species:Mouse
Vector:pCMV3-C-HA
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
 
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name
Background

RPRD1B, together with RPRD1A, can accompany RNAP II from promoter regions to 3'-untranslated regions during transcription in vivo, predominantly interact with phosphorylated RNAP II, and can reduce CTD S5- and S7-phosphorylated RNAP II at target gene promoters. RNA polymerase II C-terminal domain (CTD) phosphorylation is important for various transcription-related processes. RPRD1B is a transcriptional regulator which enhances expression of CCND1. It also enhances the transcription of a number of other cell cycle-related genes including CDK2, CDK4, CDK6 and cyclin-E but not CDKN1A, CDKN1B or cyclin-A.

References
  • Ni Z. et al., 2011, Transcription. 2 (5): 237-42.
  • Kristensen AR. et al., 2012, Nat Methods. 9 (9): 907-9.
  • Woods NT. et al., 2012, Sci Signal.5 (242): rs6.
  • Size / Price
    Catalog:MG53089-CY
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"