Quick Order

Text Size:AAA

Mouse CANX ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CANX cDNA Clone Product Information
Gene_bank_ref_id:NM_007597.3
RefSeq ORF Size:1776bp
cDNA Description:Full length Clone DNA of Mus musculus calnexin with C terminal His tag.
Gene Synonym:Cnx; AI988026; D11Ertd153e; 1110069N15Rik
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Calnexin is a calcium-binding protein that belongs to the calreticulin family. It interacts with newly synthesized glycoproteins in the endoplasmic reticulum. Calnexin seems to play a major role in the quality control apparatus of the ER by the retention of incorrectly folded proteins. It may act in assisting protein assembly and/or in the retention within the ER of unassembled protein subunits. Associated with partial T-cell antigen receptor complexes that escape the ER of immature thymocytes, it may function as a signaling complex regulating thymocyte maturation. Additionally it may play a role in receptor-mediated endocytosis at the synapse.

References
  • Rajagopalan S, et al. (1994) Retention of unassembled components of integral membrane proteins by Calnexin(CANX). Science. 263(5145):387-90.
  • Lenter M, et al. (1994) The integrin chains beta 1 and alpha 6 associate with the chaperone Calnexin(CANX) prior to integrin assembly. J Biol Chem. 269(16):12263-8.
  • Pind S, et al. (1994) Retention of unassembled components of integral membrane proteins by Calnexin(CANX). Science. 263(5145):387-90.
  • Size / Price
    Catalog: MG53126-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"