After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse CNPY4 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CNPY4 cDNA Clone Product Information
Gene_bank_ref_id:NM_178612.4
RefSeq ORF Size:738bp
cDNA Description:Full length Clone DNA of Mus musculus canopy 4 homolog (zebrafish) with C terminal His tag.
Gene Synonym:2610019P18Rik
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

CNPY4 belongs to the canopy family. CNPY4 interacts with toll-like receptor 4 (TLR4) and plays a role in the regulation of the cell surface expression of TLR4. Toll-like receptors (TLRs) recognize microbial products and induce immune responses. Lipopolysaccharide is recognized by the receptor complex consisting of TLR4 and MD-2. As CNPY4, PRAT4B also regulates cell surface expression of TLR4. PRAT4B has a signal peptide followed by a mature peptide. It is associated with the hypoglycosylated, immature form of TLR4 but not with MD-2 or TLR2.

References
  • Stelzl U, et al. (2005) A human protein-protein interaction network: a resource for annotating the proteome. Cell. 122(6):957-68.
  • Hocking JC, et al. (2010) Distinct roles for Robo2 in the regulation of axon and dendrite growth by retinal ganglion cells. Mech Dev. 127(1-2):36-48.
  • Hart BE, et al. (2012) Cell surface trafficking of TLR1 is differentially regulated by the chaperones PRAT4A and PRAT4B. J Biol Chem. 287(20):16550-62.
  • Size / Price
    Catalog: MG53099-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"