Quick Order

Mouse LCK natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse LCK cDNA Clone Product Information
Gene_bank_ref_id:NM_001162433.1
RefSeq ORF Size:1530bp
cDNA Description:Full length Clone DNA of Mus musculus lymphocyte protein tyrosine kinase.
Gene Synonym:Lsk; Lskt; Hck-3; p56Lck; p56<lck>
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Protein kinases are critically involved in signaling pathways that regulate cell growth, differentiation, activation, and survival. Initially identified as a T-cell specific member of the Src family of protein tyrosine kinases, Lck has become the object of intensive investigations which have revealed a key role for this kinase in the central processes controlling T-cell development, activation, proliferation and survival. Lck is expressed specifically in lymphoid cells. It contains one protein kinase domain, one SH2 domain, and one SH3 domain. It is associated with a variety of cell surface receptors and is critical for signal transduction from the T-cell antigen receptor (TCR). Consequently, Lck is targeted by regulatory proteins of T-lymphotropic viruses, especially by the Herpesvirus saimiri (HVS) tyrosine kinase interacting protein (Tip). This oncoprotein physically interacts with Lck in HVS transformed T cells and has an impact on its catalytic activity. Together with the identification of defects in the regulation of Lck expression or activity in T-cell leukemias, suggests that dysregulation of Lck might play a role in neoplastic transformation. However, under certain conditions Lck is also involved in the induction of apoptosis. This chemosensitizing effect of Lck is independent of T-cell receptor signaling and does not require the kinase activity of Lck. The findings demonstrate that Lck might be part of two independent signaling pathways leading to either cell proliferation or apoptosis.

References
  • Majolini MB, et al. (1999) Dysregulation of the protein tyrosine kinase LCK in lymphoproliferative disorders and in other neoplasias. Leuk Lymphoma. 35(3-4): 245-54.
  • Isakov N, et al. (2000) Lck protein tyrosine kinase is a key regulator of T-cell activation and a target for signal intervention by Herpesvirus saimiri and other viral gene products. Eur J Biochem. 267(12): 3413-21.
  • Heyninck K, et al. (2006) A novel link between Lck, Bak expression and chemosensitivity. Oncogene. 25(12): 1693-5.
  • Size / Price
    Catalog: MG53117-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"